Transcript: Mouse NM_029406.4

Mus musculus PIH1 domain containing 1 (Pih1d1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pih1d1 (68845)
Length:
1196
CDS:
243..1115

Additional Resources:

NCBI RefSeq record:
NM_029406.4
NBCI Gene record:
Pih1d1 (68845)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029406.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195949 CGTCGCTGTCAATAGCAACTT pLKO.1 605 CDS 100% 4.950 6.930 N Pih1d1 n/a
2 TRCN0000340831 CGTCGCTGTCAATAGCAACTT pLKO_005 605 CDS 100% 4.950 6.930 N Pih1d1 n/a
3 TRCN0000179474 GCTGAAGTTGACCTTCCTAAA pLKO.1 906 CDS 100% 10.800 8.640 N Pih1d1 n/a
4 TRCN0000340767 GCTGAAGTTGACCTTCCTAAA pLKO_005 906 CDS 100% 10.800 8.640 N Pih1d1 n/a
5 TRCN0000340833 AGTATGGCCTACAGCTAAATC pLKO_005 700 CDS 100% 13.200 9.240 N Pih1d1 n/a
6 TRCN0000184498 GACCAACTCATCGGAAGGAAA pLKO.1 413 CDS 100% 4.950 3.465 N Pih1d1 n/a
7 TRCN0000340830 GACCAACTCATCGGAAGGAAA pLKO_005 413 CDS 100% 4.950 3.465 N Pih1d1 n/a
8 TRCN0000184008 CTTGAGGACAAGTATGGCCTA pLKO.1 690 CDS 100% 2.160 1.512 N Pih1d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029406.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.