Transcript: Mouse NM_029413.4

Mus musculus microrchidia 4 (Morc4), transcript variant B, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Morc4 (75746)
Length:
4409
CDS:
282..2933

Additional Resources:

NCBI RefSeq record:
NM_029413.4
NBCI Gene record:
Morc4 (75746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029413.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176453 CCCGTTTCATATTCCTGATAA pLKO.1 3708 3UTR 100% 13.200 18.480 N Morc4 n/a
2 TRCN0000243872 TAAGCCTACCTCCACGAATAA pLKO_005 1202 CDS 100% 13.200 18.480 N Morc4 n/a
3 TRCN0000243874 TATCAGCTTGTGAGTACTAAT pLKO_005 2935 3UTR 100% 13.200 18.480 N Morc4 n/a
4 TRCN0000178535 GCCCGTTTCATATTCCTGATA pLKO.1 3707 3UTR 100% 4.950 6.930 N Morc4 n/a
5 TRCN0000243870 GACTTCGATACAGATCAATAT pLKO_005 981 CDS 100% 13.200 10.560 N Morc4 n/a
6 TRCN0000243873 ATCATAACAACCGCCTTATTA pLKO_005 1285 CDS 100% 15.000 10.500 N Morc4 n/a
7 TRCN0000176506 CCACTGGCATTCTGAATATAA pLKO.1 2657 CDS 100% 15.000 10.500 N Morc4 n/a
8 TRCN0000177445 CCGTTTCATATTCCTGATAAT pLKO.1 3709 3UTR 100% 13.200 9.240 N Morc4 n/a
9 TRCN0000176507 CTGCTAGATAATGCTGTAGAT pLKO.1 450 CDS 100% 4.950 3.465 N Morc4 n/a
10 TRCN0000176844 GCCATCTTGAACTATTCGATT pLKO.1 849 CDS 100% 4.950 3.465 N Morc4 n/a
11 TRCN0000178363 GCCAGAAACAGAGTATTCCTT pLKO.1 1064 CDS 100% 3.000 2.100 N Morc4 n/a
12 TRCN0000243871 CATCGCGGAGCTGCTAGATAA pLKO_005 440 CDS 100% 13.200 7.920 N Morc4 n/a
13 TRCN0000177801 CCGGAGAAACAAAGATGGAAA pLKO.1 950 CDS 100% 4.950 2.970 N Morc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029413.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.