Transcript: Mouse NM_029432.2

Mus musculus RIKEN cDNA 4930402H24 gene (4930402H24Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
4930402H24Rik (228602)
Length:
6639
CDS:
100..3639

Additional Resources:

NCBI RefSeq record:
NM_029432.2
NBCI Gene record:
4930402H24Rik (228602)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029432.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182096 CGGAATTGACAGCAGGTACAA pLKO.1 261 CDS 100% 4.950 3.960 N 4930402H24Rik n/a
2 TRCN0000181224 CAGTCAGAATGCCACTGATTT pLKO.1 327 CDS 100% 13.200 9.240 N 4930402H24Rik n/a
3 TRCN0000177091 CCAAGGTCACTTACAGATATT pLKO.1 600 CDS 100% 13.200 9.240 N 4930402H24Rik n/a
4 TRCN0000200150 CCCAAGACTGACCTTGCTAAT pLKO.1 4454 3UTR 100% 10.800 7.560 N 4930402H24Rik n/a
5 TRCN0000198645 CTGTGAATAACCAGGGAAGAA pLKO.1 1391 CDS 100% 4.950 3.465 N 4930402H24Rik n/a
6 TRCN0000182199 CCCTTCTCATACACTTCCGAA pLKO.1 1910 CDS 100% 2.640 1.848 N 4930402H24Rik n/a
7 TRCN0000200440 GCACTTTGCTAACAGGAGGAA pLKO.1 1715 CDS 100% 2.640 1.848 N 4930402H24Rik n/a
8 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 4862 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029432.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.