Transcript: Mouse NM_029440.3

Mus musculus WD40 repeat domain 95 (Wdr95), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Wdr95 (381693)
Length:
2482
CDS:
393..2321

Additional Resources:

NCBI RefSeq record:
NM_029440.3
NBCI Gene record:
Wdr95 (381693)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215889 CCGAAGAATAAACGTGTATTT pLKO.1 1118 CDS 100% 13.200 18.480 N Wdr95 n/a
2 TRCN0000267851 AGTTACGATGGAGAGATAATA pLKO_005 1266 CDS 100% 15.000 12.000 N Wdr95 n/a
3 TRCN0000346142 ACCGAAGAATAAACGTGTATT pLKO_005 1117 CDS 100% 13.200 10.560 N Wdr95 n/a
4 TRCN0000267807 CTACTGTCAGCTCGAAGAAAG pLKO_005 2085 CDS 100% 10.800 8.640 N Wdr95 n/a
5 TRCN0000267806 ACATGGAGGTGAACCGAAATC pLKO_005 1072 CDS 100% 10.800 7.560 N Wdr95 n/a
6 TRCN0000346200 CAGCGGAAGAAGGCTTGTTAC pLKO_005 947 CDS 100% 10.800 7.560 N Wdr95 n/a
7 TRCN0000189853 GAATCCTTACCTGCCTGGAAA pLKO.1 473 CDS 100% 4.950 3.465 N Wdr95 n/a
8 TRCN0000192144 GTGAAAGTGTGGGACTTTGAA pLKO.1 855 CDS 100% 0.563 0.338 N Wdr95 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.