Transcript: Mouse NM_029497.1

Mus musculus URB1 ribosome biogenesis 1 homolog (S. cerevisiae) (Urb1), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Urb1 (207932)
Length:
7381
CDS:
74..6907

Additional Resources:

NCBI RefSeq record:
NM_029497.1
NBCI Gene record:
Urb1 (207932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029497.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367216 CAAGCTTTCGAGGCCATATTA pLKO_005 371 CDS 100% 15.000 21.000 N Urb1 n/a
2 TRCN0000367217 TTATCGGGCCACCATCATAAA pLKO_005 5932 CDS 100% 13.200 18.480 N Urb1 n/a
3 TRCN0000377192 TTGGTCATGGATTGGTATTAA pLKO_005 7142 3UTR 100% 15.000 12.000 N Urb1 n/a
4 TRCN0000367288 ACTCAGCATTATCCCTTATTT pLKO_005 1440 CDS 100% 15.000 10.500 N Urb1 n/a
5 TRCN0000367214 CATGTTCACTCAGGCATTAAA pLKO_005 1396 CDS 100% 15.000 10.500 N Urb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029497.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.