Transcript: Mouse NM_029686.4

Mus musculus polycystic kidney disease 1 like 2 (Pkd1l2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pkd1l2 (76645)
Length:
7386
CDS:
1..7386

Additional Resources:

NCBI RefSeq record:
NM_029686.4
NBCI Gene record:
Pkd1l2 (76645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029686.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072154 GCGTATTCCTTTGCGTCAAAT pLKO.1 6976 CDS 100% 13.200 18.480 N Pkd1l2 n/a
2 TRCN0000072155 CCCTGCATTTGGCTATCCTAA pLKO.1 1907 CDS 100% 4.950 6.930 N Pkd1l2 n/a
3 TRCN0000072156 GCTTCGGGTTATAGACCATTT pLKO.1 3117 CDS 100% 10.800 7.560 N Pkd1l2 n/a
4 TRCN0000072153 CGGGAATAAATGCTGAAGCAA pLKO.1 1652 CDS 100% 3.000 2.100 N Pkd1l2 n/a
5 TRCN0000072157 GCAGCTTTACAATCTGACCTT pLKO.1 1206 CDS 100% 2.640 1.848 N Pkd1l2 n/a
6 TRCN0000077972 CCCATCAACCTCCTGATTGTT pLKO.1 4816 CDS 100% 5.625 3.938 N PKD1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029686.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.