Transcript: Mouse NM_029770.2

Mus musculus unc-5 netrin receptor B (Unc5b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Unc5b (107449)
Length:
5867
CDS:
417..3254

Additional Resources:

NCBI RefSeq record:
NM_029770.2
NBCI Gene record:
Unc5b (107449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072079 CGCCTACATCGTAAAGAACAA pLKO.1 584 CDS 100% 4.950 6.930 N Unc5b n/a
2 TRCN0000072078 CCTAAACTACTTCGCCACCAA pLKO.1 3092 CDS 100% 2.640 3.696 N Unc5b n/a
3 TRCN0000072082 CTACATATCAACAAGGCCGAA pLKO.1 2160 CDS 100% 2.160 1.728 N Unc5b n/a
4 TRCN0000421994 AGGTGGAATGGCTCAAGAATG pLKO_005 967 CDS 100% 10.800 7.560 N UNC5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.