Transcript: Mouse NM_029777.3

Mus musculus rhomboid domain containing 1 (Rhbdd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rhbdd1 (76867)
Length:
3533
CDS:
150..1097

Additional Resources:

NCBI RefSeq record:
NM_029777.3
NBCI Gene record:
Rhbdd1 (76867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032724 CCGGAGGCTTTGTCAACATTT pLKO.1 625 CDS 100% 13.200 10.560 N Rhbdd1 n/a
2 TRCN0000326223 CCGGAGGCTTTGTCAACATTT pLKO_005 625 CDS 100% 13.200 10.560 N Rhbdd1 n/a
3 TRCN0000331447 GGTAAAGCCTGGGCCCTTAAT pLKO_005 1416 3UTR 100% 13.200 9.240 N Rhbdd1 n/a
4 TRCN0000032725 CCTCTCTCAAGTGTTCCAAAT pLKO.1 194 CDS 100% 10.800 7.560 N Rhbdd1 n/a
5 TRCN0000326222 CCTCTCTCAAGTGTTCCAAAT pLKO_005 194 CDS 100% 10.800 7.560 N Rhbdd1 n/a
6 TRCN0000032726 GAAAGTTCTTAGCAACCATTA pLKO.1 599 CDS 100% 10.800 7.560 N Rhbdd1 n/a
7 TRCN0000326294 GAAAGTTCTTAGCAACCATTA pLKO_005 599 CDS 100% 10.800 7.560 N Rhbdd1 n/a
8 TRCN0000032727 CAGCGTCTTCACAGATTTGAT pLKO.1 1068 CDS 100% 5.625 3.938 N Rhbdd1 n/a
9 TRCN0000326224 CAGCGTCTTCACAGATTTGAT pLKO_005 1068 CDS 100% 5.625 3.938 N Rhbdd1 n/a
10 TRCN0000032728 CTGGCATTTGTATTTCAACAT pLKO.1 383 CDS 100% 4.950 2.970 N Rhbdd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.