Transcript: Mouse NM_029792.1

Mus musculus beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) (B3gat1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
B3gat1 (76898)
Length:
3474
CDS:
218..1222

Additional Resources:

NCBI RefSeq record:
NM_029792.1
NBCI Gene record:
B3gat1 (76898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093985 GCCTACTTTAAGCTACGTGGT pLKO.1 1028 CDS 100% 2.160 3.024 N B3gat1 n/a
2 TRCN0000093988 GCACGTAGAGACACCACGCAA pLKO.1 649 CDS 100% 0.880 0.704 N B3gat1 n/a
3 TRCN0000093987 GCGAAGTCAAGCCTACTTTAA pLKO.1 1018 CDS 100% 13.200 9.240 N B3gat1 n/a
4 TRCN0000093984 CCCAGCTTGATGTCAGGATAA pLKO.1 1352 3UTR 100% 10.800 7.560 N B3gat1 n/a
5 TRCN0000152693 GCAATAGACATGGCTGGATTT pLKO.1 971 CDS 100% 10.800 7.560 N B3GAT1 n/a
6 TRCN0000093986 GTAGTGTACTTCGCGGATGAT pLKO.1 785 CDS 100% 4.950 3.465 N B3gat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.