Transcript: Mouse NM_029804.3

Mus musculus heterogeneous nuclear ribonucleoprotein M (Hnrnpm), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpm (76936)
Length:
2532
CDS:
80..2269

Additional Resources:

NCBI RefSeq record:
NM_029804.3
NBCI Gene record:
Hnrnpm (76936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348710 CAATCGCTTTGAGCCATATTC pLKO_005 250 CDS 100% 13.200 18.480 N Hnrnpm n/a
2 TRCN0000123826 CCACCCAGTATCCTAAATAAT pLKO.1 614 CDS 100% 15.000 10.500 N Hnrnpm n/a
3 TRCN0000123827 GCAGACATTCTGGAAGATAAA pLKO.1 773 CDS 100% 13.200 9.240 N Hnrnpm n/a
4 TRCN0000351871 GCAGACATTCTGGAAGATAAA pLKO_005 773 CDS 100% 13.200 9.240 N Hnrnpm n/a
5 TRCN0000123824 GCTGGATGTATAAAGATGTTT pLKO.1 2345 3UTR 100% 5.625 3.938 N Hnrnpm n/a
6 TRCN0000351872 GCTGGATGTATAAAGATGTTT pLKO_005 2345 3UTR 100% 5.625 3.938 N Hnrnpm n/a
7 TRCN0000001245 GAGAGGAGAGATCATTGCAAA pLKO.1 1219 CDS 100% 4.950 3.465 N HNRNPM n/a
8 TRCN0000123828 GCTGAAGTTCTAAACAAGCAT pLKO.1 461 CDS 100% 3.000 2.100 N Hnrnpm n/a
9 TRCN0000351870 GCTGAAGTTCTAAACAAGCAT pLKO_005 461 CDS 100% 3.000 2.100 N Hnrnpm n/a
10 TRCN0000001247 GATGGCTACGACTGGTGGGAT pLKO.1 556 CDS 100% 0.880 0.616 N HNRNPM n/a
11 TRCN0000123825 GCCGAATAAATGAAATCCTAA pLKO.1 1185 CDS 100% 4.950 2.970 N Hnrnpm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.