Transcript: Mouse NM_029835.1

Mus musculus TOPBP1-interacting checkpoint and replication regulator (Ticrr), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ticrr (77011)
Length:
7213
CDS:
145..5814

Additional Resources:

NCBI RefSeq record:
NM_029835.1
NBCI Gene record:
Ticrr (77011)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380026 GAGTGCCAGCTTCAGGTATTT pLKO_005 2296 CDS 100% 13.200 18.480 N TICRR n/a
2 TRCN0000088636 ACAGTTTGGATTAGGCAGAAA pLKO.1 5400 CDS 100% 4.950 6.930 N Ticrr n/a
3 TRCN0000088637 CAGAACCTACACGAGAAAGAA pLKO.1 5781 CDS 100% 5.625 3.938 N Ticrr n/a
4 TRCN0000183420 CCAAAGAAGCTGAATTTCAAA pLKO.1 1418 CDS 100% 5.625 3.938 N Ticrr n/a
5 TRCN0000088634 CTGGCAAGAATGGAGGTCAAA pLKO.1 4997 CDS 100% 4.950 3.465 N Ticrr n/a
6 TRCN0000088633 CCCAGAAGATTCAACCCTGTT pLKO.1 6772 3UTR 100% 4.050 2.835 N Ticrr n/a
7 TRCN0000088635 CAAGGAAGAATCTGAATACAA pLKO.1 5436 CDS 100% 5.625 3.375 N Ticrr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.