Transcript: Mouse NM_029859.1

Mus musculus coiled-coil domain containing 183 (Ccdc183), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Ccdc183 (77058)
Length:
1725
CDS:
75..1679

Additional Resources:

NCBI RefSeq record:
NM_029859.1
NBCI Gene record:
Ccdc183 (77058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346443 TTTGGTAGAGAGGGTCAAATC pLKO_005 977 CDS 100% 10.800 15.120 N Ccdc183 n/a
2 TRCN0000346445 GGCTAAGAAGCATGATCAATG pLKO_005 257 CDS 100% 10.800 8.640 N Ccdc183 n/a
3 TRCN0000346446 TGTACGGCAAGCTGGATTATT pLKO_005 1384 CDS 100% 15.000 10.500 N Ccdc183 n/a
4 TRCN0000346372 CTTGGAGTCATCAACTCTAAA pLKO_005 1487 CDS 100% 13.200 9.240 N Ccdc183 n/a
5 TRCN0000346370 AGCTGCGCAAGTACGTCTTTG pLKO_005 358 CDS 100% 10.800 7.560 N Ccdc183 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.