Transcript: Mouse NM_029884.1

Mus musculus heparan-alpha-glucosaminide N-acetyltransferase (Hgsnat), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Hgsnat (52120)
Length:
2679
CDS:
34..2004

Additional Resources:

NCBI RefSeq record:
NM_029884.1
NBCI Gene record:
Hgsnat (52120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348678 ATCGCCTACGTGCTCTATAAA pLKO_005 1960 CDS 100% 15.000 21.000 N Hgsnat n/a
2 TRCN0000124999 CTGTGCTTGATTCAGAGAGAA pLKO.1 2304 3UTR 100% 4.950 3.960 N Hgsnat n/a
3 TRCN0000351722 CTGTGCTTGATTCAGAGAGAA pLKO_005 2304 3UTR 100% 4.950 3.960 N Hgsnat n/a
4 TRCN0000125002 CATGTGTGGAAATCTTGTTTA pLKO.1 2224 3UTR 100% 13.200 9.240 N Hgsnat n/a
5 TRCN0000351802 CATGTGTGGAAATCTTGTTTA pLKO_005 2224 3UTR 100% 13.200 9.240 N Hgsnat n/a
6 TRCN0000125001 GACTGTGTCATGTTGTCTGAT pLKO.1 2493 3UTR 100% 4.950 3.465 N Hgsnat n/a
7 TRCN0000125000 CAGAGATTTACTCTGGACATT pLKO.1 2251 3UTR 100% 0.495 0.347 N Hgsnat n/a
8 TRCN0000351721 CAGAGATTTACTCTGGACATT pLKO_005 2251 3UTR 100% 0.495 0.347 N Hgsnat n/a
9 TRCN0000125003 TCAGAGATTTACTCTGGACAT pLKO.1 2250 3UTR 100% 0.405 0.284 N Hgsnat n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.