Transcript: Mouse NM_029896.1

Mus musculus WD repeat domain containing 82 (Wdr82), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Wdr82 (77305)
Length:
4313
CDS:
291..1232

Additional Resources:

NCBI RefSeq record:
NM_029896.1
NBCI Gene record:
Wdr82 (77305)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251140 TGCAGCCAACACAGTCGTTTA pLKO_005 509 CDS 100% 10.800 8.640 N Wdr82 n/a
2 TRCN0000345989 CTGATGCTGCTGGGCTATTTA pLKO_005 1235 3UTR 100% 15.000 10.500 N Wdr82 n/a
3 TRCN0000251141 GAACGGAGAGAGTGGTATAAA pLKO_005 1088 CDS 100% 15.000 10.500 N Wdr82 n/a
4 TRCN0000251142 TTTGATCCAGAAGGGTTAATT pLKO_005 753 CDS 100% 15.000 10.500 N Wdr82 n/a
5 TRCN0000330747 TTTGATCCAGAAGGGTTAATT pLKO_005 753 CDS 100% 15.000 10.500 N WDR82 n/a
6 TRCN0000345953 TGACACTCGAAGCTTCATTTA pLKO_005 1012 CDS 100% 13.200 9.240 N Wdr82 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.