Transcript: Mouse NM_029911.5

Mus musculus potassium channel, subfamily K, member 10 (Kcnk10), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Kcnk10 (72258)
Length:
7363
CDS:
386..1993

Additional Resources:

NCBI RefSeq record:
NM_029911.5
NBCI Gene record:
Kcnk10 (72258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029911.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125689 CGTGCCTTAAATAGACTTCTT pLKO.1 2085 3UTR 100% 4.950 3.960 N Kcnk10 n/a
2 TRCN0000125691 GCCATGCTGACAGAGTGTATA pLKO.1 1880 CDS 100% 13.200 9.240 N Kcnk10 n/a
3 TRCN0000125692 CCAGGAACTAGAGACACTGAT pLKO.1 739 CDS 100% 4.950 3.465 N Kcnk10 n/a
4 TRCN0000125693 CCCACTCACTGGACATGCTAT pLKO.1 1533 CDS 100% 4.950 3.465 N Kcnk10 n/a
5 TRCN0000125690 CGGAATTACTCTCTGGATGAA pLKO.1 1805 CDS 100% 4.950 3.465 N Kcnk10 n/a
6 TRCN0000044581 GCTGGAATTGGAGACCAACTT pLKO.1 974 CDS 100% 4.950 3.465 N KCNK10 n/a
7 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 5411 3UTR 100% 15.000 7.500 Y KAAG1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5407 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000044582 GTCCTCAGTATGATCGGAGAT pLKO.1 1316 CDS 100% 4.050 2.835 N KCNK10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029911.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.