Transcript: Mouse NM_029928.2

Mus musculus protein tyrosine phosphatase, receptor type, B (Ptprb), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ptprb (19263)
Length:
11912
CDS:
253..6249

Additional Resources:

NCBI RefSeq record:
NM_029928.2
NBCI Gene record:
Ptprb (19263)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220413 CGGTGTATATCAATGGCTCTA pLKO.1 836 CDS 100% 4.050 5.670 N Ptprb n/a
2 TRCN0000029926 CCGAGTGAAGTGTGACCATTA pLKO.1 5679 CDS 100% 10.800 7.560 N Ptprb n/a
3 TRCN0000220412 CCACCTCTACAACCTCACTAT pLKO.1 1044 CDS 100% 4.950 3.465 N Ptprb n/a
4 TRCN0000220411 CCCATAAAGATCAATCAGTTT pLKO.1 5299 CDS 100% 4.950 3.465 N Ptprb n/a
5 TRCN0000220414 CCAGGGAATCAGTGTTAGCAA pLKO.1 2457 CDS 100% 3.000 2.100 N Ptprb n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7164 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.