Transcript: Mouse NM_029947.2

Mus musculus PR domain containing 8 (Prdm8), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Prdm8 (77630)
Length:
3119
CDS:
247..2313

Additional Resources:

NCBI RefSeq record:
NM_029947.2
NBCI Gene record:
Prdm8 (77630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358531 GGCACATGACCTCGCATAATT pLKO_005 2291 CDS 100% 15.000 21.000 N PRDM8 n/a
2 TRCN0000086010 CCTGTGTACTGAGCCATACTT pLKO.1 374 CDS 100% 5.625 7.875 N Prdm8 n/a
3 TRCN0000415067 GTCCAATCAGCCCGAGATAAG pLKO_005 520 CDS 100% 10.800 8.640 N Prdm8 n/a
4 TRCN0000418861 CTCCGACCTGGTGTACCATAT pLKO_005 2154 CDS 100% 10.800 7.560 N Prdm8 n/a
5 TRCN0000432415 TTGCAACATATTGATGCATTT pLKO_005 2687 3UTR 100% 10.800 7.560 N Prdm8 n/a
6 TRCN0000086008 GCACTTATGGTTTAGATGTAA pLKO.1 2735 3UTR 100% 5.625 3.938 N Prdm8 n/a
7 TRCN0000086009 GCCAAAGATGAAGAGTTACTA pLKO.1 607 CDS 100% 5.625 3.938 N Prdm8 n/a
8 TRCN0000086012 CGCCAAATGCAACGCCTCCTT pLKO.1 2124 CDS 100% 0.880 0.616 N Prdm8 n/a
9 TRCN0000086011 GTACCTTACATCTTCCGGGTA pLKO.1 448 CDS 100% 0.000 0.000 N Prdm8 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2493 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.