Transcript: Mouse NM_030071.1

Mus musculus maestro heat-like repeat family member 9 (Mroh9), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Mroh9 (78258)
Length:
2956
CDS:
140..2815

Additional Resources:

NCBI RefSeq record:
NM_030071.1
NBCI Gene record:
Mroh9 (78258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341945 CATGCTTACCCTTCGAAATAT pLKO_005 1969 CDS 100% 15.000 21.000 N Mroh9 n/a
2 TRCN0000352506 AGTCTGATAGAGTCCAATTTA pLKO_005 2726 CDS 100% 15.000 12.000 N Mroh9 n/a
3 TRCN0000341946 TGGTTATCACCAGGGTATTAA pLKO_005 570 CDS 100% 15.000 12.000 N Mroh9 n/a
4 TRCN0000341944 ACCCTCGAAGGGAACGAAATA pLKO_005 2690 CDS 100% 13.200 10.560 N Mroh9 n/a
5 TRCN0000341878 AGTATCGATGCTCCGTGTTTA pLKO_005 623 CDS 100% 13.200 9.240 N Mroh9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.