Transcript: Mouse NM_030112.2

Mus musculus RTF1, Paf1/RNA polymerase II complex component (Rtf1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rtf1 (76246)
Length:
4680
CDS:
1..2148

Additional Resources:

NCBI RefSeq record:
NM_030112.2
NBCI Gene record:
Rtf1 (76246)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241454 GGAATCGGGAGTGGAATATTG pLKO_005 1712 CDS 100% 13.200 18.480 N Rtf1 n/a
2 TRCN0000241455 GTTCGGTTATCACGGCATAAG pLKO_005 1099 CDS 100% 10.800 15.120 N Rtf1 n/a
3 TRCN0000241451 TAAGGAAGCTCTCAATTATAA pLKO_005 1452 CDS 100% 15.000 10.500 N Rtf1 n/a
4 TRCN0000241453 TGGCTATGGAGAGGATCTTAT pLKO_005 555 CDS 100% 13.200 9.240 N Rtf1 n/a
5 TRCN0000241452 TGCTGCTTCCAACCCTGCATG pLKO_005 2161 3UTR 100% 1.350 0.945 N Rtf1 n/a
6 TRCN0000426881 GAACTGGGAAGAGACTCTAAA pLKO_005 2247 3UTR 100% 13.200 7.920 N RTF1 n/a
7 TRCN0000022362 GCTGAAAGTCACAACATGAAA pLKO.1 1756 CDS 100% 5.625 3.938 N RTF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.