Transcript: Mouse NM_030235.1

Mus musculus AVL9 cell migration associated (Avl9), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Avl9 (78937)
Length:
6691
CDS:
218..2167

Additional Resources:

NCBI RefSeq record:
NM_030235.1
NBCI Gene record:
Avl9 (78937)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341548 AGTCTACTTCTGACGTCTTAA pLKO_005 1008 CDS 100% 13.200 18.480 N Avl9 n/a
2 TRCN0000341547 ACTTCATTCTGAGCCTAATTA pLKO_005 2402 3UTR 100% 15.000 10.500 N Avl9 n/a
3 TRCN0000341615 CAGTGATTCTGGCCGATATTT pLKO_005 1147 CDS 100% 15.000 10.500 N Avl9 n/a
4 TRCN0000341618 CCGGCACTTTCAGAGATAAAT pLKO_005 1883 CDS 100% 15.000 10.500 N Avl9 n/a
5 TRCN0000341614 TATCTCTTGTTATCGACAAAT pLKO_005 487 CDS 100% 13.200 9.240 N Avl9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.