Transcript: Mouse NM_030611.3

Mus musculus aldo-keto reductase family 1, member C6 (Akr1c6), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Akr1c6 (83702)
Length:
1359
CDS:
49..1020

Additional Resources:

NCBI RefSeq record:
NM_030611.3
NBCI Gene record:
Akr1c6 (83702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030611.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042250 GTCCTCGATGACCTGAATAAA pLKO.1 931 CDS 100% 15.000 10.500 N Akr1c6 n/a
2 TRCN0000042251 CATAAGTGGTTCTAGCTTTAA pLKO.1 963 CDS 100% 13.200 9.240 N Akr1c6 n/a
3 TRCN0000042249 CGCCAAGAGTTTCTCTGAGAA pLKO.1 852 CDS 100% 4.950 3.465 N Akr1c6 n/a
4 TRCN0000042252 GCAACTCCAGTTGGACTATGT pLKO.1 360 CDS 100% 4.950 3.465 N Akr1c6 n/a
5 TRCN0000042248 GCCATATTGATTCTGCTTCTA pLKO.1 188 CDS 100% 4.950 3.465 N Akr1c6 n/a
6 TRCN0000036543 CGCCATATTGATTCTGCTTAT pLKO.1 187 CDS 100% 10.800 6.480 N AKR1C4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030611.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.