Transcript: Mouse NM_030614.2

Mus musculus fibroblast growth factor 16 (Fgf16), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Fgf16 (80903)
Length:
3040
CDS:
65..688

Additional Resources:

NCBI RefSeq record:
NM_030614.2
NBCI Gene record:
Fgf16 (80903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059036 CGAAGAAACTCACACGTGAAT pLKO.1 441 CDS 100% 4.950 6.930 N FGF16 n/a
2 TRCN0000067086 GAGACAGTATTATGTGGCCCT pLKO.1 538 CDS 100% 0.540 0.432 N Fgf16 n/a
3 TRCN0000067083 GACTCGGAGAGACAGTATTAT pLKO.1 530 CDS 100% 15.000 10.500 N Fgf16 n/a
4 TRCN0000067087 CACAGACTTCGCCCACCTGAA pLKO.1 214 CDS 100% 1.350 0.945 N Fgf16 n/a
5 TRCN0000067084 CTGGAATTTATCAGCTTGGCT pLKO.1 344 CDS 100% 0.750 0.525 N Fgf16 n/a
6 TRCN0000067085 TCCGGGAACAGTTTGAAGAAA pLKO.1 468 CDS 100% 5.625 3.375 N Fgf16 n/a
7 TRCN0000378767 TTCCGGGAACAGTTTGAAGAA pLKO_005 467 CDS 100% 4.950 2.970 N FGF16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.