Transcript: Mouse NM_030689.4

Mus musculus neuronal pentraxin receptor (Nptxr), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Nptxr (73340)
Length:
4973
CDS:
127..1608

Additional Resources:

NCBI RefSeq record:
NM_030689.4
NBCI Gene record:
Nptxr (73340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030689.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063496 CGGTGCCGTCATCTGCATCAT pLKO.1 174 CDS 100% 1.650 1.155 N NPTXR n/a
2 TRCN0000219475 CTTGGTCTCTCCCATCATATA pLKO.1 1865 3UTR 100% 13.200 6.600 Y Nptxr n/a
3 TRCN0000219473 CAAGCCACACGGCATCCTTAT pLKO.1 1347 CDS 100% 10.800 5.400 Y Nptxr n/a
4 TRCN0000219472 GACAGCAACTGGCACCATATC pLKO.1 1231 CDS 100% 10.800 5.400 Y Nptxr n/a
5 TRCN0000219474 GATACCTTGGGAGGCCGATTT pLKO.1 1384 CDS 100% 10.800 5.400 Y Nptxr n/a
6 TRCN0000195811 CACTCCAAGATGGACGAACTA pLKO.1 799 CDS 100% 4.950 2.475 Y Npcd n/a
7 TRCN0000195742 CGTTGGTGACATTGCACAGTT pLKO.1 1422 CDS 100% 4.950 2.475 Y Npcd n/a
8 TRCN0000181119 CCAAGATGGACGAACTAGAAT pLKO.1 803 CDS 100% 5.625 2.813 Y Npcd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030689.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.