Transcript: Human NM_030775.2

Homo sapiens Wnt family member 5B (WNT5B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
WNT5B (81029)
Length:
2184
CDS:
146..1225

Additional Resources:

NCBI RefSeq record:
NM_030775.2
NBCI Gene record:
WNT5B (81029)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123196 CCCGAGATGTTTATCATCGGT pLKO.1 254 CDS 100% 0.750 1.050 N WNT5B n/a
2 TRCN0000123195 GTGTATAAGATGGCAGACGTA pLKO.1 770 CDS 100% 2.640 2.112 N WNT5B n/a
3 TRCN0000123194 GCCTCACAAAGGTCTATATTA pLKO.1 1260 3UTR 100% 15.000 10.500 N WNT5B n/a
4 TRCN0000420501 GGAAAGGAAGAGCTTATTTAA pLKO_005 1355 3UTR 100% 15.000 10.500 N WNT5B n/a
5 TRCN0000123197 GTGGACCAGTACATCTGTAAA pLKO.1 1202 CDS 100% 13.200 9.240 N WNT5B n/a
6 TRCN0000420582 GTAAATGGGTGGGTGCTATAC pLKO_005 1317 3UTR 100% 10.800 7.560 N WNT5B n/a
7 TRCN0000437705 GAATTGCAGCACAGCGGACAA pLKO_005 421 CDS 100% 4.050 2.835 N WNT5B n/a
8 TRCN0000123198 AGAAGAACTTTGCCAAAGGAT pLKO.1 690 CDS 100% 3.000 2.100 N WNT5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.