Transcript: Human NM_030782.5

Homo sapiens CLPTM1 like (CLPTM1L), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CLPTM1L (81037)
Length:
2492
CDS:
259..1875

Additional Resources:

NCBI RefSeq record:
NM_030782.5
NBCI Gene record:
CLPTM1L (81037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030782.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143850 CCGAATTTCAGTTTGGCACTT pLKO.1 1394 CDS 100% 4.050 5.670 N CLPTM1L n/a
2 TRCN0000140940 CGTGTGAACATCTGTCTTGGT pLKO.1 2061 3UTR 100% 2.640 2.112 N CLPTM1L n/a
3 TRCN0000138981 CCAGCCAAGTGCAACTTGAAT pLKO.1 1894 3UTR 100% 5.625 3.938 N CLPTM1L n/a
4 TRCN0000145064 CGTTCCATCTTCTCTTTGATT pLKO.1 1142 CDS 100% 5.625 3.938 N CLPTM1L n/a
5 TRCN0000144274 CAGTTTCTGGAAGAAGAAGAA pLKO.1 1185 CDS 100% 4.950 3.465 N CLPTM1L n/a
6 TRCN0000143441 GACTTTGATGTGGAGTCCAAA pLKO.1 493 CDS 100% 4.950 3.465 N CLPTM1L n/a
7 TRCN0000122180 GATTTCCATTTCAGGTGGTTT pLKO.1 2204 3UTR 100% 4.950 3.465 N CLPTM1L n/a
8 TRCN0000140800 GTACGATACTCAGGCCATGAA pLKO.1 1443 CDS 100% 4.950 3.465 N CLPTM1L n/a
9 TRCN0000139988 GCCAGAAGAAATCAACCTGCT pLKO.1 669 CDS 100% 2.160 1.512 N CLPTM1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030782.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.