Transcript: Human NM_030785.4

Homo sapiens radial spoke head 6 homolog A (RSPH6A), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RSPH6A (81492)
Length:
2442
CDS:
133..2286

Additional Resources:

NCBI RefSeq record:
NM_030785.4
NBCI Gene record:
RSPH6A (81492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030785.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415256 CATCGTCCCTAAGTCCGTATG pLKO_005 1335 CDS 100% 6.000 8.400 N RSPH6A n/a
2 TRCN0000425745 CATCTGTGAACACGGGCTTTC pLKO_005 395 CDS 100% 6.000 8.400 N RSPH6A n/a
3 TRCN0000179077 CTAACGCCACTTTCAGAAGAT pLKO.1 1906 CDS 100% 4.950 3.960 N RSPH6A n/a
4 TRCN0000416456 TACGAGCACCTGGTGAATCTG pLKO_005 784 CDS 100% 4.950 3.465 N RSPH6A n/a
5 TRCN0000180793 GAACCCTTTGCAGAAGACAGA pLKO.1 1803 CDS 100% 2.640 1.848 N RSPH6A n/a
6 TRCN0000415079 CCTACAAGATGGCGGAGAAAC pLKO_005 935 CDS 100% 10.800 6.480 N RSPH6A n/a
7 TRCN0000180111 CCTCAGCCTTACTCTGATGAA pLKO.1 430 CDS 100% 4.950 2.970 N RSPH6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030785.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.