Transcript: Human NM_030797.4

Homo sapiens family with sequence similarity 49 member A (FAM49A), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM49A (81553)
Length:
4670
CDS:
222..1193

Additional Resources:

NCBI RefSeq record:
NM_030797.4
NBCI Gene record:
FAM49A (81553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030797.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134135 CTGACCTCAGAAGATGTATAT pLKO.1 1223 3UTR 100% 13.200 18.480 N FAM49A n/a
2 TRCN0000136255 GCACCTAGACATTGAGAATGA pLKO.1 731 CDS 100% 4.950 6.930 N FAM49A n/a
3 TRCN0000184729 CCAGAGATCCGAGATGCAATT pLKO.1 399 CDS 100% 10.800 8.640 N Fam49a n/a
4 TRCN0000135692 CAATCGAATGTCCCTCTTCTA pLKO.1 770 CDS 100% 4.950 3.960 N FAM49A n/a
5 TRCN0000135569 GCTGACCTCAGAAGATGTATA pLKO.1 1222 3UTR 100% 13.200 9.240 N FAM49A n/a
6 TRCN0000168535 CGTTTCCTTCTTGTCACTGAA pLKO.1 1295 3UTR 100% 4.950 3.465 N FAM49A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030797.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.