Transcript: Human NM_030816.5

Homo sapiens ankyrin repeat domain 13C (ANKRD13C), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ANKRD13C (81573)
Length:
5658
CDS:
315..1940

Additional Resources:

NCBI RefSeq record:
NM_030816.5
NBCI Gene record:
ANKRD13C (81573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030816.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144861 GATGGCTCCATCTTTACTATA pLKO.1 1875 CDS 100% 13.200 18.480 N ANKRD13C n/a
2 TRCN0000142889 CAGGAGTTTCGATACGATGAA pLKO.1 1851 CDS 100% 4.950 6.930 N ANKRD13C n/a
3 TRCN0000142083 CCGATTCGAAGACAGTCTCTT pLKO.1 1530 CDS 100% 4.950 6.930 N ANKRD13C n/a
4 TRCN0000141647 CCAGGAATTTCCCTTAGGGAT pLKO.1 1682 CDS 100% 2.640 2.112 N ANKRD13C n/a
5 TRCN0000144617 GCAATTCATTGTGGTGCTATT pLKO.1 2620 3UTR 100% 10.800 7.560 N ANKRD13C n/a
6 TRCN0000144775 CCTGATGAATGTCTCAAGAAT pLKO.1 3245 3UTR 100% 5.625 3.938 N ANKRD13C n/a
7 TRCN0000121834 GCTTAGAGAATTTGTTCAGAT pLKO.1 1757 CDS 100% 4.950 3.465 N ANKRD13C n/a
8 TRCN0000144668 GCACTTTAACAAGCTTAGAGA pLKO.1 1745 CDS 100% 3.000 2.100 N ANKRD13C n/a
9 TRCN0000145445 GCAGTGATATTTACTCTGCAA pLKO.1 1279 CDS 100% 2.640 1.848 N ANKRD13C n/a
10 TRCN0000176586 CATAGACTTTACTGACATGAA pLKO.1 1106 CDS 100% 4.950 2.970 N Ankrd13c n/a
11 TRCN0000121737 CCTGGTGAATGGACTTGTTAT pLKO.1 1400 CDS 100% 13.200 9.240 N ANKRD13C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030816.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.