Transcript: Mouse NM_030889.2

Mus musculus sortilin-related VPS10 domain containing receptor 2 (Sorcs2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Sorcs2 (81840)
Length:
5722
CDS:
95..3574

Additional Resources:

NCBI RefSeq record:
NM_030889.2
NBCI Gene record:
Sorcs2 (81840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126428 CGCTGAACTCTCATAGAATCA pLKO.1 3225 CDS 100% 4.950 3.960 N Sorcs2 n/a
2 TRCN0000126425 GCTGCTTGTGACTGTGGTAAA pLKO.1 3097 CDS 100% 10.800 7.560 N Sorcs2 n/a
3 TRCN0000126424 GCCTTGAAACTGAAGTCAGTA pLKO.1 4665 3UTR 100% 4.950 3.465 N Sorcs2 n/a
4 TRCN0000126426 GCCTAGAGAAGATGTGCTGTT pLKO.1 2479 CDS 100% 4.050 2.835 N Sorcs2 n/a
5 TRCN0000126427 CTACAGATCATCAGCACGGAT pLKO.1 1259 CDS 100% 2.640 1.848 N Sorcs2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.