Transcript: Human NM_030928.4

Homo sapiens chromatin licensing and DNA replication factor 1 (CDT1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CDT1 (81620)
Length:
2664
CDS:
44..1684

Additional Resources:

NCBI RefSeq record:
NM_030928.4
NBCI Gene record:
CDT1 (81620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030928.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414448 ACCTGGTGGATTCACATTAAA pLKO_005 1880 3UTR 100% 15.000 21.000 N CDT1 n/a
2 TRCN0000431614 GCATGTCAAGGAGCACCACAA pLKO_005 955 CDS 100% 4.050 3.240 N CDT1 n/a
3 TRCN0000073298 GACCTCCTAAACTCTAATAAA pLKO.1 2625 3UTR 100% 15.000 10.500 N CDT1 n/a
4 TRCN0000422556 TAATCTTGGAACCTCTGAATA pLKO_005 2053 3UTR 100% 13.200 9.240 N CDT1 n/a
5 TRCN0000426843 TTATGAACATGATACACTTTG pLKO_005 1754 3UTR 100% 10.800 7.560 N CDT1 n/a
6 TRCN0000427564 ACCTACGTCAAGCTGGACAAG pLKO_005 1598 CDS 100% 4.050 2.835 N CDT1 n/a
7 TRCN0000222583 GTCAGATTACCAGCTCACCAT pLKO.1 835 CDS 100% 2.640 1.848 N CDT1 n/a
8 TRCN0000073301 CGGAGCGTCTTTGTGTCCGAA pLKO.1 1427 CDS 100% 0.880 0.616 N CDT1 n/a
9 TRCN0000073299 CGCTTCAACGTGGATGAAGTA pLKO.1 1043 CDS 100% 0.495 0.347 N CDT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030928.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.