Transcript: Human NM_030957.4

Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 10 (ADAMTS10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ADAMTS10 (81794)
Length:
4251
CDS:
287..3598

Additional Resources:

NCBI RefSeq record:
NM_030957.4
NBCI Gene record:
ADAMTS10 (81794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030957.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374430 CAAATCGCGTCAGTGTAAATA pLKO_005 1741 CDS 100% 15.000 21.000 N Adamts10 n/a
2 TRCN0000419865 CAAATCGCGTCAGTGTAAATA pLKO_005 1741 CDS 100% 15.000 21.000 N ADAMTS10 n/a
3 TRCN0000421200 CATTTGCGTCAGTGGCGAATG pLKO_005 2296 CDS 100% 6.000 8.400 N ADAMTS10 n/a
4 TRCN0000050329 GCACCGTTAACATCCTCGTAA pLKO.1 1131 CDS 100% 4.950 6.930 N ADAMTS10 n/a
5 TRCN0000427048 AGACGGAGCCGGAAGTTATTT pLKO_005 3706 3UTR 100% 15.000 10.500 N ADAMTS10 n/a
6 TRCN0000050331 CATCCCTTTCCGTGGGAAATT pLKO.1 2140 CDS 100% 13.200 9.240 N ADAMTS10 n/a
7 TRCN0000050328 CCTACGATGCAGATGAGCAAT pLKO.1 1701 CDS 100% 4.950 3.465 N ADAMTS10 n/a
8 TRCN0000050332 GACGAGGAAGAGTACCTGATT pLKO.1 740 CDS 100% 4.950 3.465 N ADAMTS10 n/a
9 TRCN0000050330 GACAAGATGATGGTGGCCTAT pLKO.1 1028 CDS 100% 4.050 2.835 N ADAMTS10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030957.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.