Transcript: Mouse NM_031168.2

Mus musculus interleukin 6 (Il6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Il6 (16193)
Length:
1141
CDS:
79..714

Additional Resources:

NCBI RefSeq record:
NM_031168.2
NBCI Gene record:
Il6 (16193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067549 GCAATGGCAATTCTGATTGTA pLKO.1 287 CDS 100% 5.625 3.938 N Il6 n/a
2 TRCN0000067552 CCAATGCTCTCCTAACAGATA pLKO.1 587 CDS 100% 4.950 3.465 N Il6 n/a
3 TRCN0000067551 CCAGAGTCCTTCAGAGAGATA pLKO.1 494 CDS 100% 4.950 3.465 N Il6 n/a
4 TRCN0000067548 CCTGTCTATACCACTTCACAA pLKO.1 208 CDS 100% 4.950 3.465 N Il6 n/a
5 TRCN0000067550 CCAGAGATACAAAGAAATGAT pLKO.1 349 CDS 100% 5.625 3.375 N Il6 n/a
6 TRCN0000174121 CCAGAGATACAAAGAAATGAT pLKO.1 349 CDS 100% 5.625 3.375 N Il6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.