Transcript: Mouse NM_031196.3

Mus musculus solute carrier family 19 (folate transporter), member 1 (Slc19a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc19a1 (20509)
Length:
2354
CDS:
184..1722

Additional Resources:

NCBI RefSeq record:
NM_031196.3
NBCI Gene record:
Slc19a1 (20509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068516 CGCCTACTCCTCCTACATATT pLKO.1 579 CDS 100% 13.200 18.480 N Slc19a1 n/a
2 TRCN0000303083 CGCCTACTCCTCCTACATATT pLKO_005 579 CDS 100% 13.200 18.480 N Slc19a1 n/a
3 TRCN0000068515 GCAGGTGACTAACGAGATCAT pLKO.1 363 CDS 100% 4.950 6.930 N Slc19a1 n/a
4 TRCN0000068517 CCTGGAACGTAAATTCACCAA pLKO.1 339 CDS 100% 2.640 3.696 N Slc19a1 n/a
5 TRCN0000315467 CCTGGAACGTAAATTCACCAA pLKO_005 339 CDS 100% 2.640 3.696 N Slc19a1 n/a
6 TRCN0000068514 CCGTATCTACTTCATATACTT pLKO.1 1458 CDS 100% 5.625 3.938 N Slc19a1 n/a
7 TRCN0000303010 CCGTATCTACTTCATATACTT pLKO_005 1458 CDS 100% 5.625 3.938 N Slc19a1 n/a
8 TRCN0000068513 CCTCTTTCTAAAGCGCCCTAA pLKO.1 777 CDS 100% 4.050 2.835 N Slc19a1 n/a
9 TRCN0000315539 CCTCTTTCTAAAGCGCCCTAA pLKO_005 777 CDS 100% 4.050 2.835 N Slc19a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.