Transcript: Human NM_031215.2

Homo sapiens Cdk5 and Abl enzyme substrate 2 (CABLES2), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CABLES2 (81928)
Length:
3785
CDS:
8..1444

Additional Resources:

NCBI RefSeq record:
NM_031215.2
NBCI Gene record:
CABLES2 (81928)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121991 GTTAGAAGAAAGGTTTCGATT pLKO.1 1306 CDS 100% 4.950 6.930 N CABLES2 n/a
2 TRCN0000142742 CCACAGTGATAGAATACGTGA pLKO.1 993 CDS 100% 2.640 3.696 N CABLES2 n/a
3 TRCN0000140415 GCCCATGTTACGAGCATGTAA pLKO.1 3260 3UTR 100% 5.625 4.500 N CABLES2 n/a
4 TRCN0000140533 GTCAAACTGACGCTGAGCAAA pLKO.1 1070 CDS 100% 4.950 3.960 N CABLES2 n/a
5 TRCN0000143084 CCCTTCAGTTATGTCCCATTT pLKO.1 3460 3UTR 100% 10.800 7.560 N CABLES2 n/a
6 TRCN0000139761 CGCAGAAAGGAGATGCCAATT pLKO.1 2878 3UTR 100% 10.800 7.560 N CABLES2 n/a
7 TRCN0000139342 CCGGTCTTTGTGATGTGTGAA pLKO.1 3434 3UTR 100% 4.950 3.465 N CABLES2 n/a
8 TRCN0000139383 CCTCATCTTTGCGTCGTACAT pLKO.1 970 CDS 100% 4.950 3.465 N CABLES2 n/a
9 TRCN0000143558 GAGACATAAAGGCCTGAAGAA pLKO.1 466 CDS 100% 4.950 3.465 N CABLES2 n/a
10 TRCN0000143610 GAGAACCAAGTGTTACCTCAT pLKO.1 1397 CDS 100% 4.050 2.835 N CABLES2 n/a
11 TRCN0000139656 CGTGTCTTATGCGAAGTTCCT pLKO.1 724 CDS 100% 2.640 1.848 N CABLES2 n/a
12 TRCN0000122870 GCTCCAGCACAGAGAACCAAA pLKO.1 428 CDS 100% 4.950 2.970 N CABLES2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.