Transcript: Human NM_031217.4

Homo sapiens kinesin family member 18A (KIF18A), mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
KIF18A (81930)
Length:
3417
CDS:
140..2836

Additional Resources:

NCBI RefSeq record:
NM_031217.4
NBCI Gene record:
KIF18A (81930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031217.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415419 ATTCTACGATGACACATATAA pLKO_005 1150 CDS 100% 15.000 21.000 N KIF18A n/a
2 TRCN0000422955 GTCGTTCATGGACTTACTTTA pLKO_005 701 CDS 100% 13.200 18.480 N KIF18A n/a
3 TRCN0000117074 GCAGACGTAAATTCTGGATTT pLKO.1 2669 CDS 100% 10.800 15.120 N KIF18A n/a
4 TRCN0000117073 CGCTTGTTAAAGGATTCTCTT pLKO.1 1079 CDS 100% 4.950 6.930 N KIF18A n/a
5 TRCN0000117072 CCCATCTTAAAGCTAAGTTTA pLKO.1 2934 3UTR 100% 13.200 10.560 N KIF18A n/a
6 TRCN0000117076 GCTCAATGATTCTCTTAGCAA pLKO.1 2212 CDS 100% 3.000 2.400 N KIF18A n/a
7 TRCN0000426193 GAAAGCACAAATTAGACATAT pLKO_005 1783 CDS 100% 13.200 9.240 N KIF18A n/a
8 TRCN0000417075 GAAAGGACAGCATACTCTAAA pLKO_005 2167 CDS 100% 13.200 9.240 N KIF18A n/a
9 TRCN0000117075 CCCGATTTGTAGAAGGCACAA pLKO.1 957 CDS 100% 4.050 2.835 N KIF18A n/a
10 TRCN0000091624 CGATTTGTAGAAGGCACAAAT pLKO.1 959 CDS 100% 1.320 0.924 N Kif18a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031217.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.