Transcript: Mouse NM_031250.5

Mus musculus urocortin 3 (Ucn3), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ucn3 (83428)
Length:
1478
CDS:
516..1010

Additional Resources:

NCBI RefSeq record:
NM_031250.5
NBCI Gene record:
Ucn3 (83428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031250.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249389 CATCGACAAGGCCAAGAATTT pLKO_005 932 CDS 100% 13.200 9.240 N Ucn3 n/a
2 TRCN0000249387 ATATCCACAATGGAGGTTAAC pLKO_005 1215 3UTR 100% 10.800 7.560 N Ucn3 n/a
3 TRCN0000249391 CACCCGGTACAGATACCAATC pLKO_005 800 CDS 100% 6.000 4.200 N Ucn3 n/a
4 TRCN0000249390 AGCCCTATCTGAGGTCAAGAA pLKO_005 629 CDS 100% 4.950 3.465 N Ucn3 n/a
5 TRCN0000192323 CCTATCTGAGGTCAAGAAGAA pLKO.1 632 CDS 100% 4.950 3.465 N Ucn3 n/a
6 TRCN0000202258 GTTCTACAACACTGGACCAGT pLKO.1 590 CDS 100% 2.640 1.848 N Ucn3 n/a
7 TRCN0000216691 CTTGATGTTCCCACTAACATC pLKO.1 894 CDS 100% 0.495 0.347 N Ucn3 n/a
8 TRCN0000249388 CTCAGCTCATGGCACAGATTG pLKO_005 976 CDS 100% 10.800 6.480 N Ucn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031250.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.