Transcript: Mouse NM_031376.3

Mus musculus phosphoinositide-3-kinase adaptor protein 1 (Pik3ap1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pik3ap1 (83490)
Length:
2615
CDS:
102..2537

Additional Resources:

NCBI RefSeq record:
NM_031376.3
NBCI Gene record:
Pik3ap1 (83490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364220 GAAACCACCGTCAGCTATTAT pLKO_005 873 CDS 100% 15.000 21.000 N Pik3ap1 n/a
2 TRCN0000364219 ACTCGATGATCCGCAAGTTTC pLKO_005 1549 CDS 100% 10.800 15.120 N Pik3ap1 n/a
3 TRCN0000364221 TCGAGCATCTACGACCCATTT pLKO_005 1872 CDS 100% 10.800 15.120 N Pik3ap1 n/a
4 TRCN0000088630 GCCCACTAAAGACTCGATGAT pLKO.1 1538 CDS 100% 4.950 6.930 N Pik3ap1 n/a
5 TRCN0000088629 CGTCAGCTATTATACCGACAT pLKO.1 881 CDS 100% 4.050 5.670 N Pik3ap1 n/a
6 TRCN0000088632 CCGTCAGCTATTATACCGACA pLKO.1 880 CDS 100% 2.160 3.024 N Pik3ap1 n/a
7 TRCN0000088628 CCTGACAATGAGCCATACATT pLKO.1 1743 CDS 100% 5.625 4.500 N Pik3ap1 n/a
8 TRCN0000364218 CGACAACGAGGACAACGAAAT pLKO_005 2333 CDS 100% 10.800 7.560 N Pik3ap1 n/a
9 TRCN0000088631 GCCACAGAAGACCTCTATGTT pLKO.1 1464 CDS 100% 5.625 3.938 N Pik3ap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.