Transcript: Mouse NM_031384.2

Mus musculus testis expressed gene 11 (Tex11), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tex11 (83558)
Length:
3250
CDS:
150..2993

Additional Resources:

NCBI RefSeq record:
NM_031384.2
NBCI Gene record:
Tex11 (83558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216871 GAAGCAAGCAAGCGGAATAAA pLKO.1 798 CDS 100% 15.000 21.000 N Tex11 n/a
2 TRCN0000190396 CCAGAAGTGTTAAGGTCCAAA pLKO.1 1381 CDS 100% 4.950 6.930 N Tex11 n/a
3 TRCN0000191644 GCAGATGAAGTATGGAATATA pLKO.1 2586 CDS 100% 15.000 10.500 N Tex11 n/a
4 TRCN0000200692 GCAGCTAAACTGTGTTATATT pLKO.1 387 CDS 100% 15.000 10.500 N Tex11 n/a
5 TRCN0000216973 CCTGCATACTATCCTACTATT pLKO.1 2460 CDS 100% 13.200 9.240 N Tex11 n/a
6 TRCN0000200843 GCTGCTAAGGAAATACTATAT pLKO.1 1077 CDS 100% 13.200 9.240 N Tex11 n/a
7 TRCN0000192407 CAGTGGAGAGTCATAATGATT pLKO.1 3073 3UTR 100% 5.625 3.938 N Tex11 n/a
8 TRCN0000202442 GCCATAGCAGAAGTTGAGCAA pLKO.1 1542 CDS 100% 2.640 1.848 N Tex11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.