Transcript: Mouse NM_031387.3

Mus musculus tudor domain containing 1 (Tdrd1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tdrd1 (83561)
Length:
5047
CDS:
219..3737

Additional Resources:

NCBI RefSeq record:
NM_031387.3
NBCI Gene record:
Tdrd1 (83561)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031387.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437454 GACCAACTCCAGGCGATATTA pLKO_005 2625 CDS 100% 15.000 21.000 N Tdrd1 n/a
2 TRCN0000434184 GGAATGTTAAAGTCCACTTTG pLKO_005 2572 CDS 100% 10.800 15.120 N Tdrd1 n/a
3 TRCN0000192852 GATGACTTGAATCAGTCCTTA pLKO.1 2427 CDS 100% 4.950 6.930 N Tdrd1 n/a
4 TRCN0000191995 GCAAATGTACTAGAGATCATA pLKO.1 3024 CDS 100% 5.625 4.500 N Tdrd1 n/a
5 TRCN0000217886 GTTTCCTCCTTCTGCCATAAA pLKO.1 1316 CDS 100% 13.200 9.240 N Tdrd1 n/a
6 TRCN0000217838 CTCTAGTCAAGGAGATCTTAC pLKO.1 2545 CDS 100% 10.800 7.560 N Tdrd1 n/a
7 TRCN0000190677 GCAGACCTGCTAATCAACATA pLKO.1 2917 CDS 100% 5.625 3.938 N Tdrd1 n/a
8 TRCN0000436261 GTGACAGTTGAGAGCAAGATT pLKO_005 1611 CDS 100% 5.625 3.938 N Tdrd1 n/a
9 TRCN0000189725 GCTCAGTTCTCAGAGGATGAT pLKO.1 1851 CDS 100% 4.950 3.465 N Tdrd1 n/a
10 TRCN0000201238 GTTGCCAAATACACAGTTGAT pLKO.1 1161 CDS 100% 4.950 3.465 N Tdrd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031387.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.