Transcript: Human NM_031419.4

Homo sapiens NFKB inhibitor zeta (NFKBIZ), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
NFKBIZ (64332)
Length:
3923
CDS:
116..2272

Additional Resources:

NCBI RefSeq record:
NM_031419.4
NBCI Gene record:
NFKBIZ (64332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031419.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364803 GAGTCTGGTTGATACCATTAA pLKO_005 1882 CDS 100% 13.200 18.480 N NFKBIZ n/a
2 TRCN0000148089 GCTGGATATTAAAGAGCACAA pLKO.1 1531 CDS 100% 4.050 5.670 N NFKBIZ n/a
3 TRCN0000128305 GCTTATGAACCAAACCTCTTT pLKO.1 1076 CDS 100% 4.950 3.960 N NFKBIZ n/a
4 TRCN0000364866 CACTTCACATGCTGGATATTA pLKO_005 1521 CDS 100% 15.000 10.500 N NFKBIZ n/a
5 TRCN0000150086 CAGTATCGGTTGACACAATTA pLKO.1 2093 CDS 100% 13.200 9.240 N NFKBIZ n/a
6 TRCN0000369625 GCAGAGAGCTCCACCGTATTA pLKO_005 2251 CDS 100% 13.200 9.240 N NFKBIZ n/a
7 TRCN0000369626 GTATCTGTACATAGACCATTT pLKO_005 2329 3UTR 100% 10.800 7.560 N NFKBIZ n/a
8 TRCN0000148570 CCAATGAACACCACACAGTTA pLKO.1 1334 CDS 100% 4.950 3.465 N NFKBIZ n/a
9 TRCN0000081761 GAAGCAAATCTGGAACTCATT pLKO.1 1982 CDS 100% 4.950 3.465 N Nfkbiz n/a
10 TRCN0000147551 GAAGCAAATCTGGAACTCATT pLKO.1 1982 CDS 100% 4.950 3.465 N NFKBIZ n/a
11 TRCN0000131219 GCTCAACCTGAGCTACTTCTA pLKO.1 202 CDS 100% 4.950 3.465 N NFKBIZ n/a
12 TRCN0000149301 GTTTCCCTGAACACAGTTCAA pLKO.1 803 CDS 100% 4.950 3.465 N NFKBIZ n/a
13 TRCN0000128389 GCAAGAAAGATGAATGCACTT pLKO.1 1505 CDS 100% 4.050 2.835 N NFKBIZ n/a
14 TRCN0000147259 GAAGTCATAAACAGAAGGCTT pLKO.1 498 CDS 100% 2.640 1.848 N NFKBIZ n/a
15 TRCN0000369624 TGATCTGCTTCAGAACATTAT pLKO_005 757 CDS 100% 13.200 7.920 N NFKBIZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031419.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.