Transcript: Human NM_031862.4

Homo sapiens NBR1 autophagy cargo receptor (NBR1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
NBR1 (4077)
Length:
4727
CDS:
213..3113

Additional Resources:

NCBI RefSeq record:
NM_031862.4
NBCI Gene record:
NBR1 (4077)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370576 GATAGAAGCCCTTGCTTATTT pLKO_005 3182 3UTR 100% 15.000 21.000 N NBR1 n/a
2 TRCN0000365517 ACTGGTACAGCCAACGCTATT pLKO_005 3091 CDS 100% 10.800 15.120 N NBR1 n/a
3 TRCN0000365455 TGATATCGAAGCTATGGTAAA pLKO_005 299 CDS 100% 10.800 15.120 N NBR1 n/a
4 TRCN0000365456 CCTCAAGCTTCATAGTTATTT pLKO_005 3567 3UTR 100% 15.000 10.500 N NBR1 n/a
5 TRCN0000365518 CCTTTGAGCTGTTGGATATAA pLKO_005 1897 CDS 100% 15.000 10.500 N NBR1 n/a
6 TRCN0000365516 GCCTATGCCCATCCTACAATA pLKO_005 907 CDS 100% 13.200 9.240 N NBR1 n/a
7 TRCN0000377595 AGAATATGAAGAAGCGCTTAA pLKO_005 398 CDS 100% 10.800 7.560 N NBR1 n/a
8 TRCN0000123161 GCCAGGAACCAAGTTTATCAA pLKO.1 1373 CDS 100% 5.625 3.938 N NBR1 n/a
9 TRCN0000123162 CCATCCTACAATATCTGTGAA pLKO.1 915 CDS 100% 4.950 3.465 N NBR1 n/a
10 TRCN0000123160 GCAGCATTTGTGGATGAGAAT pLKO.1 1329 CDS 100% 4.950 3.465 N NBR1 n/a
11 TRCN0000123159 GCTTCATAGTTATTTGGCATT pLKO.1 3573 3UTR 100% 4.050 2.835 N NBR1 n/a
12 TRCN0000123163 GCAGTTAAACAGGGAAACCAA pLKO.1 423 CDS 100% 3.000 2.100 N NBR1 n/a
13 TRCN0000123386 CCCATCTCTTTGAAATGGGAT pLKO.1 2977 CDS 100% 0.264 0.185 N Nbr1 n/a
14 TRCN0000370575 GCTCCAGAAACAGGTTGATAA pLKO_005 1076 CDS 100% 13.200 7.920 N NBR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.