Transcript: Human NM_031865.1

Homo sapiens protocadherin alpha 13 (PCDHA13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
PCDHA13 (56136)
Length:
2427
CDS:
1..2424

Additional Resources:

NCBI RefSeq record:
NM_031865.1
NBCI Gene record:
PCDHA13 (56136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425784 GACTGGATCCCAACGATTATT pLKO_005 512 CDS 100% 15.000 21.000 N PCDHA13 n/a
2 TRCN0000055686 GCGCCATTATTGCCCTAATCA pLKO.1 1097 CDS 100% 5.625 7.875 N PCDHA13 n/a
3 TRCN0000417555 CATTAGTGATCAAGCTAAATG pLKO_005 776 CDS 100% 13.200 9.240 N PCDHA13 n/a
4 TRCN0000055685 GATGGTACAAATGGAGATATA pLKO.1 811 CDS 100% 13.200 9.240 N PCDHA13 n/a
5 TRCN0000432545 GTATGGCCTGCAGTGGTATAT pLKO_005 853 CDS 100% 13.200 9.240 N PCDHA13 n/a
6 TRCN0000055684 GAGAGGAAATTCAGGAACATA pLKO.1 605 CDS 100% 5.625 3.938 N PCDHA13 n/a
7 TRCN0000055683 CCCTGAAAGCAAGAAACGAAT pLKO.1 399 CDS 100% 4.950 3.465 N PCDHA13 n/a
8 TRCN0000055687 CGCTGGTGGATGTCAATGTTT pLKO.1 2075 CDS 100% 5.625 3.375 N PCDHA13 n/a
9 TRCN0000053275 CTGGAGGTAAATCTGCAGAAT pLKO.1 223 CDS 100% 4.950 2.475 Y PCDHA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.