Transcript: Mouse NM_031872.2

Mus musculus taste receptor, type 1, member 3 (Tas1r3), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tas1r3 (83771)
Length:
3514
CDS:
20..2596

Additional Resources:

NCBI RefSeq record:
NM_031872.2
NBCI Gene record:
Tas1r3 (83771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072168 GCCGAGTAAAGGGCTTTCATT pLKO.1 1560 CDS 100% 5.625 7.875 N Tas1r3 n/a
2 TRCN0000452797 GAACCTAGCCCTACCAGAAAT pLKO_005 2624 3UTR 100% 13.200 9.240 N Tas1r3 n/a
3 TRCN0000072172 CCAAGTGCTATGTGCTTCTTT pLKO.1 2469 CDS 100% 5.625 3.938 N Tas1r3 n/a
4 TRCN0000072171 GCACATCACCAATGCAATGTT pLKO.1 2233 CDS 100% 5.625 3.938 N Tas1r3 n/a
5 TRCN0000072169 GCCCTACACCTGTATTACATA pLKO.1 1428 CDS 100% 5.625 3.938 N Tas1r3 n/a
6 TRCN0000072170 GCTATGACCTATTTGACACAT pLKO.1 306 CDS 100% 4.950 3.465 N Tas1r3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.