Transcript: Human NM_031889.3

Homo sapiens enamelin (ENAM), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ENAM (10117)
Length:
5679
CDS:
282..3710

Additional Resources:

NCBI RefSeq record:
NM_031889.3
NBCI Gene record:
ENAM (10117)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434758 GAAGGAGATAGTCCCTTATAA pLKO_005 2216 CDS 100% 15.000 21.000 N ENAM n/a
2 TRCN0000083342 GCGGTATAATCAATTCAACTT pLKO.1 455 CDS 100% 4.950 6.930 N ENAM n/a
3 TRCN0000413191 GAATCCTTACTTTGGATATTT pLKO_005 869 CDS 100% 15.000 12.000 N ENAM n/a
4 TRCN0000083341 CCTAACACATTGGTTGAGTTA pLKO.1 3558 CDS 100% 4.950 3.960 N ENAM n/a
5 TRCN0000433232 CCTCACTCTGAGGGTTATATG pLKO_005 1701 CDS 100% 13.200 9.240 N ENAM n/a
6 TRCN0000083338 GCAGATTAACTTTCCATTCTA pLKO.1 4068 3UTR 100% 5.625 3.938 N ENAM n/a
7 TRCN0000083339 GCCCTGTTGTTCGCAATGAAA pLKO.1 1555 CDS 100% 5.625 3.938 N ENAM n/a
8 TRCN0000083340 CCTCCTTATTATTCAGAAGAA pLKO.1 915 CDS 100% 4.950 3.465 N ENAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.