Transcript: Human NM_031891.4

Homo sapiens cadherin 20 (CDH20), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CDH20 (28316)
Length:
4040
CDS:
551..2956

Additional Resources:

NCBI RefSeq record:
NM_031891.4
NBCI Gene record:
CDH20 (28316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031891.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421767 CGACTCCCTCCAGACGTATAT pLKO_005 2776 CDS 100% 13.200 18.480 N CDH20 n/a
2 TRCN0000056511 CCGGAAACAACCATACATCAT pLKO.1 2485 CDS 100% 4.950 6.930 N CDH20 n/a
3 TRCN0000431186 ATCAATGCAGAGATGAAATAT pLKO_005 1463 CDS 100% 15.000 10.500 N CDH20 n/a
4 TRCN0000416072 GAACAACCATACAGATCATTT pLKO_005 1764 CDS 100% 13.200 9.240 N CDH20 n/a
5 TRCN0000418027 GAACAACCATACAGATCATTT pLKO_005 1764 CDS 100% 13.200 9.240 N Cdh20 n/a
6 TRCN0000056512 GAGAGGAAAGAGCCCAGTATA pLKO.1 921 CDS 100% 13.200 9.240 N CDH20 n/a
7 TRCN0000426088 AGTTCCTGGACGGACCTTATG pLKO_005 1041 CDS 100% 10.800 7.560 N CDH20 n/a
8 TRCN0000056509 CCCTCTCAGATGTCAATGATA pLKO.1 1338 CDS 100% 5.625 3.938 N CDH20 n/a
9 TRCN0000056508 CCTGTCACAATCAAAGTCTTA pLKO.1 1985 CDS 100% 4.950 3.465 N CDH20 n/a
10 TRCN0000056510 GCCTTTGACATTAGCACAGAT pLKO.1 1511 CDS 100% 4.950 3.465 N CDH20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031891.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.