Transcript: Human NM_031918.4

Homo sapiens Kruppel like factor 16 (KLF16), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
KLF16 (83855)
Length:
2901
CDS:
83..841

Additional Resources:

NCBI RefSeq record:
NM_031918.4
NBCI Gene record:
KLF16 (83855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031918.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020007 CTCGCACCTAAAGTCGCACCT pLKO.1 505 CDS 100% 0.720 1.008 N KLF16 n/a
2 TRCN0000429654 GTGGGCAAACCCTGAAGACAC pLKO_005 933 3UTR 100% 1.350 1.080 N KLF16 n/a
3 TRCN0000020004 CTACAAGTCCTCGCACCTAAA pLKO.1 496 CDS 100% 10.800 7.560 N KLF16 n/a
4 TRCN0000020006 ACGTGCTCATGGCCATCTCTT pLKO.1 123 CDS 100% 4.950 3.465 N KLF16 n/a
5 TRCN0000435511 TGCGCCAAAGCCTACTACAAG pLKO_005 482 CDS 100% 4.950 3.465 N KLF16 n/a
6 TRCN0000422995 AGGGCTGCGACAAGAAGTTCG pLKO_005 567 CDS 100% 1.350 0.945 N KLF16 n/a
7 TRCN0000020008 CAAGCGCTTCACCCGCAGTGA pLKO.1 661 CDS 100% 0.000 0.000 N KLF16 n/a
8 TRCN0000020005 CCCTCTGTGCTCCAAGCGCTT pLKO.1 649 CDS 100% 0.000 0.000 N KLF16 n/a
9 TRCN0000429113 TGTGTCTGTAAATAGCCATGA pLKO_005 1048 3UTR 100% 4.050 2.430 N KLF16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031918.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.