Transcript: Human NM_031948.5

Homo sapiens serine protease 27 (PRSS27), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PRSS27 (83886)
Length:
1135
CDS:
65..937

Additional Resources:

NCBI RefSeq record:
NM_031948.5
NBCI Gene record:
PRSS27 (83886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031948.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052179 AGTGCCCTTCACCAATTACAT pLKO.1 463 CDS 100% 5.625 7.875 N PRSS27 n/a
2 TRCN0000442117 GAAACTCGCTGTGCCCATCAT pLKO_005 601 CDS 100% 4.950 6.930 N PRSS27 n/a
3 TRCN0000436215 GAACCGCCCAGGTGTCTACAT pLKO_005 832 CDS 100% 1.650 2.310 N PRSS27 n/a
4 TRCN0000052181 CAACTGGATCCATCGGATCAT pLKO.1 871 CDS 100% 4.950 3.465 N PRSS27 n/a
5 TRCN0000052178 CCATCAAGAATGACATGCTGT pLKO.1 684 CDS 100% 2.640 1.848 N PRSS27 n/a
6 TRCN0000052182 GCAAGTCAGCATCCAGCGCAA pLKO.1 208 CDS 100% 0.720 0.504 N PRSS27 n/a
7 TRCN0000052180 GAGTTTGGCTACCAACCCAAA pLKO.1 662 CDS 100% 0.405 0.284 N PRSS27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031948.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.