Transcript: Mouse NM_032005.4

Mus musculus T-box 19 (Tbx19), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Tbx19 (83993)
Length:
2662
CDS:
212..1552

Additional Resources:

NCBI RefSeq record:
NM_032005.4
NBCI Gene record:
Tbx19 (83993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_032005.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427967 CAACAGCAAGCTAGTACTAAC pLKO_005 2036 3UTR 100% 10.800 15.120 N Tbx19 n/a
2 TRCN0000084190 CATAAATATGAACCTCAGGTT pLKO.1 692 CDS 100% 2.640 2.112 N Tbx19 n/a
3 TRCN0000084188 CGCCTCATTCTGCCTTATATT pLKO.1 2509 3UTR 100% 15.000 10.500 N Tbx19 n/a
4 TRCN0000419188 AGATTCAAGGAAGTCACTAAT pLKO_005 362 CDS 100% 13.200 9.240 N Tbx19 n/a
5 TRCN0000432444 CAATGGAGGTGGGCAGATAAT pLKO_005 658 CDS 100% 13.200 9.240 N Tbx19 n/a
6 TRCN0000415369 TCCTCTTCATTGGATAGTTAG pLKO_005 1532 CDS 100% 10.800 7.560 N Tbx19 n/a
7 TRCN0000084191 CCCTCAGTGAATTTGATAGAA pLKO.1 1115 CDS 100% 5.625 3.938 N Tbx19 n/a
8 TRCN0000013354 CCTCAGTGAATTTGATAGAAA pLKO.1 1116 CDS 100% 5.625 3.938 N TBX19 n/a
9 TRCN0000084189 GCAAACAGCAATTACCAGTAT pLKO.1 977 CDS 100% 4.950 3.465 N Tbx19 n/a
10 TRCN0000084192 CAGGTTCATATAGTCCGTGTT pLKO.1 707 CDS 100% 4.050 2.835 N Tbx19 n/a
11 TRCN0000218481 CCTATCAGAATGAGGAGATAA pLKO_005 792 CDS 100% 13.200 7.920 N TBX19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032005.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.