Transcript: Human NM_032024.4

Homo sapiens leucine rich melanocyte differentiation associated (LRMDA), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
LRMDA (83938)
Length:
909
CDS:
216..812

Additional Resources:

NCBI RefSeq record:
NM_032024.4
NBCI Gene record:
LRMDA (83938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032024.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142685 CGCTACGTTTACTATGGGAAA pLKO.1 750 CDS 100% 4.050 5.670 N LRMDA n/a
2 TRCN0000141443 CATCTTGGACAACAATCAGCT pLKO.1 305 CDS 100% 2.640 2.112 N LRMDA n/a
3 TRCN0000144139 CAAGAACCGAATCACTGATTT pLKO.1 380 CDS 100% 13.200 9.240 N LRMDA n/a
4 TRCN0000142341 CAAGCTGCCCAACTTGAAATT pLKO.1 545 CDS 100% 13.200 9.240 N LRMDA n/a
5 TRCN0000142657 GAAGTGTCGCTACGTTTACTA pLKO.1 743 CDS 100% 5.625 3.938 N LRMDA n/a
6 TRCN0000144427 CAGAAAGTAACCAGACAAGAA pLKO.1 576 CDS 100% 4.950 3.465 N LRMDA n/a
7 TRCN0000145589 CAGATGCTTTGTTCTGTACAA pLKO.1 527 CDS 100% 4.950 3.465 N LRMDA n/a
8 TRCN0000144690 GAGATACAGATGCTTTGTTCT pLKO.1 521 CDS 100% 4.950 3.465 N LRMDA n/a
9 TRCN0000140640 GCCCAGAAAGTAACCAGACAA pLKO.1 573 CDS 100% 4.950 3.465 N LRMDA n/a
10 TRCN0000144332 CTACAAGAGATACAGATGCTT pLKO.1 515 CDS 100% 3.000 2.100 N LRMDA n/a
11 TRCN0000145393 GAAGACTACAAGAGATACAGA pLKO.1 510 CDS 100% 3.000 2.100 N LRMDA n/a
12 TRCN0000141991 GATGAGGAAGACTACAAGAGA pLKO.1 504 CDS 100% 3.000 2.100 N LRMDA n/a
13 TRCN0000140941 CAGAGGAGTCTTCATGAAGGT pLKO.1 614 CDS 100% 2.640 1.848 N LRMDA n/a
14 TRCN0000144295 CCCAACTTGAAATTTCTGGAT pLKO.1 552 CDS 100% 2.640 1.848 N LRMDA n/a
15 TRCN0000140889 GATTTGGAGAACCTGCTGGAT pLKO.1 396 CDS 100% 2.640 1.848 N LRMDA n/a
16 TRCN0000138983 CAGACTGCATACCTTAACCCT pLKO.1 356 CDS 100% 0.750 0.525 N LRMDA n/a
17 TRCN0000144863 GAACTCATCTTGGACAACAAT pLKO.1 300 CDS 100% 5.625 3.375 N LRMDA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032024.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.