Transcript: Human NM_032100.1

Homo sapiens protocadherin gamma subfamily B, 6 (PCDHGB6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PCDHGB6 (56100)
Length:
2463
CDS:
1..2463

Additional Resources:

NCBI RefSeq record:
NM_032100.1
NBCI Gene record:
PCDHGB6 (56100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435581 GAGATCTCATAGCTTGATATT pLKO_005 615 CDS 100% 13.200 18.480 N PCDHGB6 n/a
2 TRCN0000437989 ATCCGCTGGTACACGACTATC pLKO_005 438 CDS 100% 10.800 15.120 N PCDHGB6 n/a
3 TRCN0000056265 GCATTGCACATACGGGTACAA pLKO.1 2264 CDS 100% 4.950 6.930 N PCDHGB6 n/a
4 TRCN0000056266 GCAGAGACGAATATAGAATTA pLKO.1 728 CDS 100% 13.200 10.560 N PCDHGB6 n/a
5 TRCN0000415153 TAATTCCGATGGTGGCAAATA pLKO_005 552 CDS 100% 13.200 10.560 N PCDHGB6 n/a
6 TRCN0000056263 CGCCTCTTTCTTCCAGTAGAA pLKO.1 1289 CDS 100% 4.950 3.960 N PCDHGB6 n/a
7 TRCN0000056267 CCTACATTCCAATGAAGACAT pLKO.1 2316 CDS 100% 4.950 3.465 N PCDHGB6 n/a
8 TRCN0000056264 CCAGAGTTATCTCTGGAGAAA pLKO.1 574 CDS 100% 0.495 0.347 N PCDHGB6 n/a
9 TRCN0000094725 GCCCAGAAATAATCATCACTT pLKO.1 1031 CDS 100% 4.950 2.475 Y Pcdhgb7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.